other:Article Title: Structure of the human KMN complex and implications for regulation of its assembly
Article Snippet: Software and code Policy information about availability of computer code Data collection EPU v2.7 Thermo Fisher Scientific Image Lab Bio-rad https://www.bio-rad.com/de-de/product/image-lab-software?ID=KRE6P5E8Z Slidebook, 3i (Intelligent Imaging Innovations) FortéBio Octet BLI Data acquisition software Deltavision SoftWoRx software Data analysis cryoSPARC Version 4.2.1 (Punjani et al. 2017, https://cryosparc.com/) TranSHIRE v1.4 (Stabrin et al., 2020 https://transphire.readthedocs.io/en/latest/ MOTIONCOR2 v1.3.0 Zheng et al., 2017 http://msg.ucsf.edu/em/software/motioncor2.html CTFFIND4 (Rohou and Grigorieff, 2015 http://grigoriefflab.janelia.org/ctffind4) MOTIONCOR2 (Zheng et al., 2017 http://msg.ucsf.edu/em/software/motioncor2.html) SPHIRE v1.5 (Moriya et al., 2017 http://sphire.mpg.de) crYOLO v1.7 (Wagner et al., 2019 https://cryolo.readthedocs.io/en/stable/) RELION v3.1.2 (Scheres Lab https://www3.mrc-lmb.cam.ac.uk/relion/index.php?title=Main_Page) Pymol v2.5.4 Schrödinger, LLC https://pymol.org/2/ COOT v0.9.8.2 (Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/) PHENIX v1.20.1 (Adams et al., 2010 https://www.phenix-online.org) DeepEMhancer v0.14 (Sanchez-Garcia et al., 2021 https://github.com/rsanchezgarc/deepEMhancer) AlphaFold-Multimer v3.2.1 Evans et al., 2021 DynDom6D (Veevers and Hayward, 2019 http://dyndom.cmp.uea.ac.uk/dyndom/dyndomDownload.jsp) GraphPad Prism Version 9.0.2 (134) (GraphPad Software Inc http://www.graphpad.com) 2 nature portfolio | reporting sum m ary April 2023 Fiji Version 2.0.0-rc-69/1.52n (Schindelin et al., 2012 http://imageJ.nih.gov/ij/) CRaQ (Bodor et al., 2012 NA) Image Lab (Bio-rad, https://www.bio-rad.com/de-de/product/image-lab-software?ID=KRE6P5E8Z) Microcal PEAQ-ITC analysis software FortéBio Octet BLI Data Analysis software For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors and reviewers.
Article Title: FBP1 loss disrupts liver metabolism and promotes tumorigenesis through a hepatic stellate cell senescence secretome.
Article Snippet: Software and code Policy information about availability of computer code Data collection ViiA 7 Real-Time PCR System (Applied Biosystems), Calibur (BD BioSciences), LSR II (BD BioSciences), QE Exactive hybrid mass spectrometer (Thermo Fisher) Data analysis ViiATM 7 Software, GraphPad Prism version 7, FlowJo software v10.1, Image J software 1.49v, Microsoft Excel Version16.16.19, (200210)), MaxQuant 1.6.2.3, Xcalibur 4.3 software, R-studio (R version 3.3.3), DeSeq (Bioconductor Version 2.12).
Article Title: In vivo macrophage engineering reshapes the tumor microenvironment leading to eradication of liver metastases.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Donkey anti-Rabbit (Polyclonal) Invitrogen A11010 Rat anti-Mouse Fc Block BD Biosciences 553142 Mouse anti-LAG3 (874512) RnD Systems #Mab23196 Rabbit anti-CD4 (SP35) Roche-Ventana 5552737001 Rabbit anti-CD4 (D7D2Z) Cell Signaling Technology 25229 Mouse anti-CTLA4 (OTI1G10) Origene TA810299 Rabbit anti-EOMES (EPR19012) Abcam 183991 Donkey anti-mouse (Polyclonal) Abcam ab150105 Rat anti-IL-10R (1B1.3A) BioXCell BE0050 Rat IgG1k anti-HRP (HRPN) BioXCell BE0088 Siriam Hamster anti-mouse CTLA4 (9H10) BioXCell BE0131 Siriam Hamster Isotype control BioXCell BE0087 Rat anti-mouse CD8a (53-6.7) BioXCell BE0004-1 Rat IgG2a anti-trinitrophenol (2A3) BioXCell BE0089 Experimental models: Organisms/strains NSG Charles River Laboratory #614 C57BL/6 Charles River Laboratory #027 Nude (NU/NUCD) Charles River Laboratory #086 B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ The Jackson Laboratory #022071 B6(Cg)-Ifnar1tm1.1Ees/J The Jackson Laboratory #028256 Experimental models: Cell lines Human: HEK293T ATCC Cat# CRL-3216 Mouse: BMDMs NA NA Mouse: MC38 Provided by Amgen NA Mouse: K8484 Hingorani et al., 200526 NA Mouse: AKTPF Sakai et al., 201820 NA Deposited data scRNA and spatial transcriptomics sequencing data This paper GSE221360 Bulk RNA sequencing data This paper; Potenza et al., 202358 GSE200133 Software and algorithms R 3.6.2 http://www.R-project.org/ NA Prism 9 Version 9.3.1 https://www.graphpad.com NA FlowJo version 10.8.1 https://www.flowjo.com/ NA FCS Express Version 7.12.0007 https://denovosoftware.com/ NA QuantaSoft software (Biorad) Version 1.7 https://www.bio-rad.com/ NA MIPAV Version 11.0.7 https://mipav.cit.nih.gov/ NA Fiji - ImageJ2 version 2.3.0/1.53q https://fiji.sc/ NA Code This paper http://www.bioinfotiget.it/gitlab/ custom/squadrito_livertumor2022 Other TACTGACGCTCTCGACC ThermoFisher NA TCTCGACGCAGGACTCG ThermoFisher NA 50-(FAM)-ATCTCTCTCCTTCTAGCCTC-(MGB)-30 ThermoFisher NA ACCGATTCCAGATGATTGGC ThermoFisher NA TCCATATTAATGCAGTGCTTG ThermoFisher NA 50-(HEX)-AGAGGCCTGTCCTGCAGCTCATGG –(BHQ-1)- 30 ThermoFisher NA Hprt TaqManTM Gene Expression Assay Invitrogen Mm03024075_m1 Irf7 TaqManTM Gene Expression Assay Invitrogen Mm00516788_m1 Ifit1 TaqManTM Gene Expression Assay Invitrogen Mm00515153_m1 (Continued on next page) e2 Cancer Cell 41, 1892–1910.e1–e10, November 13, 2023
Article Title: Peptostreptococcus anaerobius promotes colorectal carcinogenesis and modulates tumour immunity.
Article Snippet: 1Institute of Digestive Disease and Department of Medicine and Therapeutics, The Chinese University of Hong Kong, Hong Kong SAR, China.. 2State Key Laboratory of Digestive Disease, Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong, Hong Kong SAR, China.. 3Chinese University of Hong Kong–Shenzhen Research Institute, Shenzhen, China.
Article Title: CPSF3-dependent pre-mRNA processing as a druggable node in AML and Ewing’s sarcoma
Article Snippet: Software and code Policy information about availability of computer code Data collection - Flow cytometry: LSR Fortessa cell analyzer (BD Biosciences) - Cmpd mass spec: Sciex 6500+ triple quad mass spectrometer - Chemoprot mass spec: LTQ Orbitrap Elite (Thermo) - RT-qPCR: ViiA-7 qPCR instrument (Applied Biosystems) - Cell viability screening assay: Perkin Elmer Viewlux or Envision plate readers - Gel or film analysis: ChemiDoc (BioRad) - Imaging smFISH and IHC: Axioimager Z1 microscope (Zeiss) - RNA sequencing: HiSeq2500 platform (Illumina) - X-ray data: Pilatus 6M detector at the Advanced Photon Source beamline Data analysis - Flow cytometry: FlowJo v10 (Flowjo LLC) - siRNA screening: RSA, GeneMANIA (genemania.org), Spotfire 6.5 (Tibco) - X-ray data analysis: autoPROC, PHASER, coot, BUSTER - Image analysis: Zen (Zeiss), Matlab (Mathworks), ImageJ - Chemoprot mass spec: Trans-proteomic pipeline (TPP) modules (Institute for Systems Biology), Mascot v 2.5.1 (Matrix Science), ProteinProphet (proteinprophet.sourceforge.net) - RNA-seq data processing o STAR v2.5.0a, read alignments (to hg19) o SAMtools v1.3.1, indexing of aligned/sorted reads - Differential gene expression and read-through analysis o QuasR v1.14.0, read counts o edgeR v3.22.3, differential expression analysis o R v3.5.0 (statistical language platform for running QuasR and edgeR) 2 nature research | reporting sum m ary O ctober 2018 o Metascape (metascape.org) For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors/reviewers.
Article Title: Treatment of influenza and SARS-CoV-2 infections via mRNA-encoded Cas13a in rodents.
Article Snippet: Software and code Policy information about availability of computer code Data collection QuantStudio 7 software vl.3 (Applied Biosystems), Volocity software v 6.3.3 (Perkin Elmer), Living image 64 bit software v 4.7.4 (Perkin Elmer), Data analysis Nanodrop 2000 software v1.6.198 (Thermo Scientific) QuantStudio 7 software vl.3 (Applied Biosystems), Volocity software v 6.3.3 (Perkin Elmer), Living image 64 bit software v4.7.4 (Perkin Elmer), Excel 2009 (Microsoft 365), Graph Pad Prism 8 software (Graph Pad), G*power software v3.1 (University of Dusseldorf), Image Studio lite v5.2 (Li-Core) For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors and reviewers.
Standard Deviation:Article Title: Structural insights into influenza A virus ribonucleoproteins reveal a processive helical track as transcription mechanism.
Article Snippet: 1Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain.. 2Unité de Génétique Moléculaire des Virus à ARN, Département de Virologie, Institut Pasteur, Paris, France.. 3Centre National de la Recherche Scientifique, Unité Mixte de Recherche 3569, Paris, France.
Software:Article Title: Structural insights into influenza A virus ribonucleoproteins reveal a processive helical track as transcription mechanism.
Article Snippet: 1Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain.. 2Unité de Génétique Moléculaire des Virus à ARN, Département de Virologie, Institut Pasteur, Paris, France.. 3Centre National de la Recherche Scientifique, Unité Mixte de Recherche 3569, Paris, France.
Article Title: Clinical Features of Fatal Pandemic Influenza A/H1N1 Infection Complicated by Invasive Pulmonary Fungal Infection
Article Snippet: Biochemical data were determined using the BD Multitest Identification Mark Kit (BD Corporation, USA, state code 340503). .. The other reagents and equipment used were as follows: fluorescein isothiocyanate antihuman CD14 (eBioscience Corporation, USA, state code IM1638U), phycoerythrin (PE) antihuman HLA-DR (eBioscience Corporation), PE mouse immunoglobulin G (IgG)2b isotype control (eBioscience Corporation, state code IM0464U), FACSort flow cytometer (BD Corporation) and CellQuest software. ..
Control:Article Title: Clinical Features of Fatal Pandemic Influenza A/H1N1 Infection Complicated by Invasive Pulmonary Fungal Infection
Article Snippet: Biochemical data were determined using the BD Multitest Identification Mark Kit (BD Corporation, USA, state code 340503). .. The other reagents and equipment used were as follows: fluorescein isothiocyanate antihuman CD14 (eBioscience Corporation, USA, state code IM1638U), phycoerythrin (PE) antihuman HLA-DR (eBioscience Corporation), PE mouse immunoglobulin G (IgG)2b isotype control (eBioscience Corporation, state code IM0464U), FACSort flow cytometer (BD Corporation) and CellQuest software. ..
Flow Cytometry:Article Title: Clinical Features of Fatal Pandemic Influenza A/H1N1 Infection Complicated by Invasive Pulmonary Fungal Infection
Article Snippet: Biochemical data were determined using the BD Multitest Identification Mark Kit (BD Corporation, USA, state code 340503). .. The other reagents and equipment used were as follows: fluorescein isothiocyanate antihuman CD14 (eBioscience Corporation, USA, state code IM1638U), phycoerythrin (PE) antihuman HLA-DR (eBioscience Corporation), PE mouse immunoglobulin G (IgG)2b isotype control (eBioscience Corporation, state code IM0464U), FACSort flow cytometer (BD Corporation) and CellQuest software. ..
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 